Oops, you're using an old version of your browser so some of the features on this page may not be displaying properly.

MINIMAL Requirements: Google Chrome 24+Mozilla Firefox 20+Internet Explorer 11Opera 15–18Apple Safari 7SeaMonkey 2.15-2.23

Poster Display session 3

1133 - the Mutant Neoantigen Specific T Cell Is a Personalized Immunotherapy in Refractory Solid Tumor

Date

30 Sep 2019

Session

Poster Display session 3

Topics

Immunotherapy

Tumour Site

Presenters

Qi Song

Citation

Annals of Oncology (2019) 30 (suppl_5): v475-v532. 10.1093/annonc/mdz253

Authors

Q. Song1, T. Zhang2, J. Li3, W. Sheng4, J. Wang1, Q. Gan1, L. Han1, Q. Sun1, N. Zhou1, X. Zhou1, Y. Zhou1, L. Wu1, J. LI3, L. Chang3, Z. Zhou2, Y. Song2, L. Zhang1, S. Jiao1

Author affiliations

  • 1 Oncology Department, the General Hospital of People’s Liberation Army, 100853 - Beijing/CN
  • 2 Research And Development Department, Beijing DCTY Biotech Co.,Ltd., 102200 - Beijing/CN
  • 3 Oncology Department, Geneplus-Beijing Institute, 102206 - Beijing/CN
  • 4 Academy Of Life Sciences, the General Hospital of People’s Liberation Army, 100853 - Beijing/CN

Resources

Login to access the resources on OncologyPRO.

If you do not have an ESMO account, please create one for free.

Abstract 1133

Background

Immune checkpoint inhibitors are an important therapy. However, their essence is nonspecific and efficiency of single usage is not satisfactory. The mutant neoantigen specific T (Nas-T) cell, as an adoptive cell treatment, is a specific immunotherapy for each individual. Our previous research has proved that the combined immunotherapy of mutant Nas-T cell and PD1 antibody is more effective than PD1 alone in prolonging PFS (World Conference on Lung Cancer 2018). We aim to evaluate the characteristics of the immune repertoire (IR) as a predictive biomarker for immunotherapy and to construct personalized and specific TCR-T.

Methods

14 patients with advanced solid tumors who failed after multiline treatments were recruited. They were divided into durable clinical benefit (complete response, partial response or stable disease for more than 3 months) and non-durable clinical benefit (DCB and NCB) based on PFS. Peripheral blood was collected at baseline and each cycle. IR-seq of the CDR3 regions of human TCRβ chains was used to interrogate the TCRs frequency. We used single neoantigen to stimulate the infused T cells and performed RNAseq for the sorted CD137(+) cells to obtain the full-length TCR α and β chain. Lastly, we constructed TCR-T cells via transfecting the TCR α/β pair into the T cells of patients and co-cultured with neoantigen to analyze the functionality of TCRs.

Results

After neoantigen pulsing, the clonality of infused T cells pool significantly increased (P = 0.0001), suggesting some tumor-specific T-cells were expanded and enriched after neoantigen pulsing. Compared to baseline, T-cell repertoire of NCB and DCB after 1st cycle displayed significant changes: Shannon 1.19 vs 0.97 (P = 0.002); clonality 0.68 vs 1.19 (P = 0.001). Elevated clonality may indicate expanded tumor-specific T-cells which could recognize mutant neoantigen specifically. Besides, based on the in vitro TCR-T experiments, the constructed TCR-T cells can specifically recognize the mutant neoantigen and lyse the target cells expressing the corresponding neoantigen.Table:

1228P

Neoantigen SequenceHLA-I typingTCR VαTCR Vβ
Gene nameSequence*All V Hits With Score#Clonal Sequence#All V Hits With Score#Clonal Sequence#
MTAP/SPINK1 Fused GeneVLLPRHMKVA0201TRAV35 (574.6)TGTGCTGGGTATGGCTCTAGCAA CACAGGCAAACTAATCTTTTRBV19 (646.8)TGTGCCAGTCGGACAGGGGGA TCACCCCTCCACTTT
FERNYVSNVSKFA2301TRAV29DV5 (667.6)TGTGCAGCTTCAACTGGGGCAAA CAACCTCTTCTTTTRBV7-2 (626.7)TGTGCCAGCACCTCTGCCCCC TCCTACGAGCAGTACTTC
SPINK1FLLSALALLB4403TRAV20 (589.1)TGTGCTGTTCCCCTGGGAACAGG CTTTCAGAAACTTGTATTT (response to neoantigen)TRBV21-1 (557.8)TGTGCCAGCAGCAAAGACCCT AGCGGGAATCAAGAGACCCAGTACTTC
CLCN6ALIGAAASLB6701TRAV19 (612.4)TGTGCTCTTCTGAATTATGGTGGTGC TACAAACAAGCTCATCTTTTRBV6-5 (675.4)TGTGCCAGCAGTGGGACAGCCAATGA GCAGTTCTTC (response to neoantigen)
MTAPAESFMFRTWC0401TRAV38-2DV8 (658.4)TGTGCTTATTGGGAGCTTGTCTCTGGGG CTGGGAGTTACCAACTCACTTTCTRBV5-1 (637.6)TGCGCCAGCAGCTTGACTAGCGGGGGG TTCTACGAGCAGTACTTC
TAP1RLSLFLALVC0702TRAV16 (622.2)TGTGCTCCCTGGGCCCTAGGAGGAGG TGCTGACGGACTCACCTTTTRBV30 (403.4)TGTGCCTGGAGTGTAACAGGGGGC AAAGCAGATACGCAGTATTTT
MAN2C1FLQGRNFFL

Conclusions

The mutant Nas-T cell is a personalized immunotherapy. IR is a potential predictive biomarker.

Clinical trial identification

Editorial acknowledgement

Legal entity responsible for the study

Shunchang Jiao.

Funding

Has not received any funding.

Disclosure

All authors have declared no conflicts of interest.

This site uses cookies. Some of these cookies are essential, while others help us improve your experience by providing insights into how the site is being used.

For more detailed information on the cookies we use, please check our Privacy Policy.

Customise settings
  • Necessary cookies enable core functionality. The website cannot function properly without these cookies, and you can only disable them by changing your browser preferences.